Trehalose limits opportunistic mycobacterial survival during HIV co-infection by reversing HIV-mediated autophagy block.

Opportunistic bacterial infections amongst HIV-infected individuals contribute significantly to HIV-associated mortality. The role of HIV-mediated modulation of innate mechanisms like autophagy in promoting opportunistic infections, however, remains obscure. Here we show, HIV reactivation in or infection of macrophages inhibits autophagy and helps the survival of pathogenic Mycobacterium tuberculosis (Mtb) and nonpathogenic non-tuberculous mycobacterial strains (NTMs). The HIV-mediated impairment of xenophagy flux facilitated bacterial survival. Activation of autophagy by trehalose could induce xenophagy flux and kill intracellular Mtb or NTMs either during single or co-infections. Trehalose, we delineate, activates PIKFYVE leading to TFEB nuclear translocation in MCOLN1-dependent manner to induce autophagy. Remarkably, trehalose significantly reduced HIV-p24 levels in ex-vivo-infected PBMCs or PBMCs from treatment-naive HIV patients and also controlled mycobacterial survival within Mtb-infected animals. To conclude, we report leveraging of HIV-mediated perturbed host innate-immunity by opportunistic bacterial pathogens and show an attractive therapeutic strategy for HIV and associated co-morbidities.Abbreviations: AIDS: acquired immune deficiency syndrome; AMPK: AMP-activated protein kinase; ATG5: autophagy related 5; BafA1: bafilomycin A1; CFU: colony forming unit; CTSD: cathepsin D; CD63: CD63 molecule; EGFP: enhanced green fluorescent protein; FRET: Förster resonance energy transfer; GABARAP: gamma-aminobutyric acid receptor-associated protein; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; GLUT: glucose transporter; HIV: human immunodeficiency virus; hMDMs: human monocyte derived macrophages; IL2: interleukin 2; LAMP1: lysosomal-associated membrane protein 1; LC3B-II: lipidated microtubule-associated proteins 1A/1B light chain 3B; Mtb: Mycobacterium tuberculosis; MTOR: mechanistic target of rapamycin; mRFP: monomeric red fluorescent protein; M6PR: mannose-6-phosphate receptor; NAC: N- acetyl- L -cysteine; NTM's: non-tuberculous mycobacteria; PBMC: Peripheral Blood Mononuclear cells; PIKFYVE: phosphoinositide kinase; FYVE-Type Zinc Finger; PHA: phytohemagglutinin; PMA: phorbol 12-myristate 13-acetate; PtdIns(3,5)P2: Phosphatidylinositol 3,5-bisphosphate; ptfLC3: pEGFP-mRFP-LC3; ROS: reactive oxygen species; SQSTM1: sequestosome1; TFEB: transcription factor EB; MCOLN1/TRPML1: mucolipin 1; PIP4P1/TMEM55B: Human trans-membrane Protein 55B; UVRAG: UV Radiation Resistance Associate; VPS35: vacuolar protein sorting associated protein 35; WDR45: WD repeat domain 45; YCAM: Yellow Chameleon.

Hepatitis E outbreak in Jaipur due to Genotype IA.

Purpose: Suddenly, many cases of fever with jaundice were reported from Sodala area at Jaipur. This outbreak of acute hepatitis at Jaipur Rajasthan was investigated for aetiology and subsequent phylogenetic analysis. Methods: Blood samples were collected from 106 symptomatic patients of acute hepatitis and 39 pregnant females (with or without symptoms of hepatitis) during an outbreak at Jaipur. The samples were tested for hepatitis A virus (HAV) and hepatitis E virus (HEV) by serological and molecular methods (polymerase chain reaction [PCR]). Sequencing of nested PCR product was done for phylogenetic analysis. Hepatitis B surface antigen (HBs antigen), anti-hepatitis C virus (HCV), anti-Leptospira and anti-scrub typhus IgM enzyme-linked immunosorbent assay (ELISA) was done for patients negative for HEV and HAV. Results: Among 106 symptomatic patients, HEV IgM was positive in 84/106 (79.2%) patients and HEV RNA in 72/106 (67.9%) patients. Among pregnant women, 6/39 (15.4%) were HEV IgM positive and 5/39 (12.8%) for HEV RNA. One (2.5%) pregnant woman died due to hepatitis. All the isolates belonged to genotype 1A of HEV. All HAV, HEV-negative samples were negative for HBs antigen, HCV antibody, Leptospira and scrub typhus IgM ELISA. Conclusion: The outbreak was due to HEV genotype 1A. The municipal water supply was contaminated and sanitary conditions and waste disposal were poor in the area. Boiling of drinking water, fixing the water supply pipes and frequent hand washing helped in controlling the outbreak.

Redox-dependent condensation of the mycobacterial nucleoid by WhiB4.

Oxidative stress response in bacteria is mediated through coordination between the regulators of oxidant-remediation systems (e.g. OxyR, SoxR) and nucleoid condensation (e.g. Dps, Fis). However, these genetic factors are either absent or rendered non-functional in the human pathogen Mycobacterium tuberculosis (Mtb). Therefore, how Mtb organizes genome architecture and regulates gene expression to counterbalance oxidative imbalance is unknown. Here, we report that an intracellular redox-sensor, WhiB4, dynamically links genome condensation and oxidative stress response in Mtb. Disruption of WhiB4 affects the expression of genes involved in maintaining redox homeostasis, central metabolism, and respiration under oxidative stress. Notably, disulfide-linked oligomerization of WhiB4 in response to oxidative stress activates the protein's ability to condense DNA. Further, overexpression of WhiB4 led to hypercondensation of nucleoids, redox imbalance and increased susceptibility to oxidative stress, whereas WhiB4 disruption reversed this effect. In accordance with the findings in vitro, ChIP-Seq data demonstrated non-specific binding of WhiB4 to GC-rich regions of the Mtb genome. Lastly, data indicate that WhiB4 deletion affected the expression of ~ 30% of genes preferentially bound by the protein, suggesting both direct and indirect effects on gene expression. We propose that WhiB4 structurally couples Mtb's response to oxidative stress with genome organization and transcription.

Molecular characterization of hepatitis A virus from children hospitalized at a tertiary care centre in northwest India.

Background & objectives: Hepatitis A virus (HAV) infection is a major cause of childhood hepatitis, prevalent worldwide. HAV is classified into seven genotypes I-VII; genotypes III and I are the most common among humans. The present work was carried out to identify the genotypes prevalent in children suspected to have acute viral hepatitis (AVH), hospitalized at a tertiary care centre in northwest India. Methods: A total of 1269 blood samples from children (0-15 yr of age) clinically suspected of viral hepatitis were screened for anti-HAV IgM. Acute phase serum was processed for RNA extraction and amplified by nested polymerase chain reaction (PCR) followed by sequencing of representative samples. Results: Among the 1269 samples tested, 642 (50.59%) were positive for anti-HAV IgM; among the positive samples, 171 patients having a history of less than seven days were tested by PCR, of whom 141 (82.45%) were found to be PCR positive. Nucleotide sequencing of a representative 44 samples showed high homology; all the samples were found to be of genotype IIIA. Interpretation & conclusions: Hepatitis A was prevalent during July to September and in predominantly children less than five years age. Only genotype IIIA was detected in all the samples.

Co-circulation of Chikungunya and Dengue viruses in Dengue endemic region of New Delhi, India during 2016.

Co-circulation of Chikungunya and Dengue viral infections (CHIKV and DENV) have been reported mainly due to transmission by common Aedes vector. The purpose of the study was to identify and characterise the circulating strains of CHIKV and DENV in DENV endemic region of New Delhi during 2016. CHIKV and DENV were identified in the blood samples (n = 130) collected from suspected patients by RT-PCR. CHIKV was identified in 26 of 65 samples (40%). Similarly, DENV was detected in 48 of 120 samples (40%). Co-infection with both the viruses was identified in five (9%) of the samples. Interestingly, concurrent infection with DENV, CHIKV and Plasmodium vivax was detected in two samples. CHIKV strains (n = 11) belonged to the ECSA genotype whereas DENV-3 sequences (n = eight) clustered in Genotype III by phylogenetic analysis. Selection pressure of E1 protein of CHIKV and CprM protein of DENV-3 revealed purifying selection with four and two positive sites, respectively. Four amino acids of the CHIKV were positively selected and had high entropy suggesting probable variations. Co-circulation of both viruses in DENV endemic regions warrants effective monitoring of these emerging pathogens via comprehensive surveillance for implementation of effective control measures.

Microwave radiation (2.45 GHz)-induced oxidative stress: Whole-body exposure effect on histopathology of Wistar rats.

Man-made microwave and radiofrequency (RF) radiation technologies have been steadily increasing with the growing demand of electronic appliances such as microwave oven and cell phones. These appliances affect biological systems by increasing free radicals, thus leading to oxidative damage. The aim of this study was to explore the effect of 2.45 GHz microwave radiation on histology and the level of lipid peroxide (LPO) in Wistar rats. Sixty-day-old male Wistar rats with 180 ± 10 g body weight were used for this study. Animals were divided into two groups: sham exposed (control) and microwave exposed. These animals were exposed for 2 h a day for 35 d to 2.45 GHz microwave radiation (power density, 0.2 mW/cm2). The whole-body specific absorption rate (SAR) was estimated to be 0.14 W/kg. After completion of the exposure period, rats were sacrificed, and brain, liver, kidney, testis and spleen were stored/preserved for determination of LPO and histological parameters. Significantly high level of LPO was observed in the liver (p < 0.001), brain (p < 0.004) and spleen (p < 0.006) in samples from rats exposed to microwave radiation. Also histological changes were observed in the brain, liver, testis, kidney and spleen after whole-body microwave exposure, compared to the control group. Based on the results obtained in this study, we conclude that exposure to microwave radiation 2 h a day for 35 d can potentially cause histopathology and oxidative changes in Wistar rats. These results indicate possible implications of such exposure on human health.

Characterisation and diagnosis of frangipani mosaic virus from India.

Frangipani mosaic virus (FrMV) is known to infect frangipani tree (Plumeria rubra f. acutifolia) in India but the virus has not been characterized at genomic level and diagnosis is not available. In the present study, an isolate of FrMV (FrMV-Ind-1) showing greenish mosaic and vein-banding symptoms in P. rubra f. acutifolia in New Delhi was characterized based on host reactions, serology and genome sequence. The virus isolate induced local symptoms on several new experimental host species: Capsicum annuum (chilli), Nicotiana benthamiana, Solanum lycopersicum and S. melongena. N. benthamiana could be used as an efficient propagation host as it developed systemic mottle mosaic symptoms all round the year. The genome of FrMV-Ind-1 was 6643 (JN555602) nucleotides long with genome organization similar to tobamoviruses. The Indian isolate of FrMV shared a very close genome sequence identity (98.3 %) with the lone isolate of FrMV-P from Australia. FrMV-Ind-1 together with FrMV-P formed a new phylogenetic group i.e. Apocynaceae-infecting tobamovirus. The polyclonal antiserum generated through the purified virus preparation was successfully utilized to detect the virus in field samples of frangipani by ELISA. Of the eight different tobamoviruses tested, FrMV-Ind-1 shared distant serological relationships with only cucumber green mottle mosaic virus, tobacco mosaic virus, bell pepper mottle virus and kyuri green mottle mosaic virus. RT-PCR based on coat protein gene primer successfully detected the virus in frangipani plants. This study is the first comprehensive description of FrMV occurring in India.

DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

Engineered Antibody Fragments for Immunodiagnosis of Papaya ringspot virus.

The present study was undertaken to clone and express the genes encoding antibody to the recombinant coat protein (rCP) of Papaya ringspot virus (PRSV) and to assess the engineered antibody for the detection of PRSV. A 33-kDa rCP of PRSV, which was produced in Escherichia coli, generated PRSV specific antibody in immunized mouse. The heavy and light chain variable domain genes (VH and VL) of 351 and 360 nucleotides, respectively, were cloned from the mRNA isolated from the spleen of the immunized mouse with rCP of PRSV. The VH and VL belong to the family IgG1 and kappa chain, respectively, and contained the framework regions and complementarity determining regions. The VH and VL genes were individually used to develop the expression constructs in pET28a (+) vector and 14-kDa proteins were obtained in E. coli. The amount of purified VH and VL proteins was 3-4 mg/l of bacterial culture. Both the antibody fragments recognized PRSV in the crude sap; however, the VL antibody fragment showed higher affinity to PRSV. The mixture of VH and VL detected PRSV as effectively as polyclonal antibody. The recombinant antibody fragments mixture detected PRSV in the field samples with 100 % accuracy in dot immunobinding assay (DIBA) and enzyme-linked immunosorbent assay (ELISA). The sensitivity of the detection of PRSV using antibody fragments was 1.0 and 10.0 ng in DIBA and ELISA, respectively. The results showed successful isolation of functional single-domain antibody encoding genes to PRSV directly from the immunized spleen cells of mouse. This study for the first time demonstrates application of bacterial expressed recombinant antibody fragments in immunodiagnosis of PRSV.

BDP-30, a systemic resistance inducer from Boerhaavia diffusa L., suppresses TMV infection, and displays homology with ribosome-inactivating proteins.

Root extract of Boerhaavia diffusa L. induced systemic resistance in tobacco against Tobacco mosaic virus. A 30 kDa protein was isolated as the active component, called BDP-30 on the basis of the molecular weight and source plant. BDP-30, a glycoprotein, was found to be temperature and protease resistant. It was basic, possessing a pI greater than 9.0. In-gel proteolytic digestion of BDP-30 generated two peptides that possessed the amino acid sequence KLYDIPPLR and KVTLPYSGNYER by LC/MS/MS. Both peptides shared absolute sequence identity with trichosanthin, a ribosome-inactivating protein from Trichosanthes kirilowii, and a 78 percent and 100 percent homology respectively with an RIP from Bryonia dioica, bryodin. Further, effort was made to look at the fate of TMV in induced resistant Nicotiana tabacum cv. Xanthi, a systemic host of the virus, at specified days after inoculation in control and treated plants. TMV coat protein (CP) was detected by immunoblot 7 days post inoculation up to 21 days in the control set, but not in treated resistant plants. TMV RNA was detected by RT-PCR using TMV-CP specific primers. Resistant tobacco did not show presence of TMV RNA up to 21 days of inoculation. This suggests that BDP-30 may be suppressing TMV replication.

Surface plasmon resonance based label-free detection of Salmonella using DNA self assembly.

Typhoid is re-emerging as a biggest health threat to third world countries. One of the major challenge is false negative diagnosis using existing immunodiagnostic methods due to overlapping symptoms of other infections (like brucellosis, malaria, hepatitis) that mimic this enteric fever (typhoid). Surface plasmon resonance (SPR) based DNA hybridisation biosensor has been fabricated by generating self-assembled monolayer of 5'-thiolated single-stranded DNA (ssDNA) probe onto gold surface. Highly specific DNA probe has been selected from conserved Vi capsular antigen gene of Salmonella enterica serovars typhi. This DNA biosensor has been investigated for label-free real-time monitoring of Salmonella. Interestingly, 0.019 ng mL(-1) (2 fM) is the lowest detected concentration in PBS with association (k a) and dissociation (k d) rate constants to be k a (M(-1) s(-1)) = 6.68 × 10(4) ± 2.3 and k d (s(-1)) = 5.6 × 10(-3) ± 0.01, respectively. This biosensor was successfully demonstrated to distinguish complementary, non-complementary and one-base mismatch sequences and reusability up to 40 hybridisation cycles at room temperature. Successful results were obtained for hybridisation studies of genomic DNA isolated from spiked urine sample. Performance characteristics of this biosensing device suggested further scope to fine-tune such DNA-based assays to be implied for clinical, food and environmental applications.

Effect of 3G cell phone exposure with computer controlled 2-D stepper motor on non-thermal activation of the hsp27/p38MAPK stress pathway in rat brain.

Cell phone radiation exposure and its biological interaction is the present concern of debate. Present study aimed to investigate the effect of 3G cell phone exposure with computer controlled 2-D stepper motor on 45-day-old male Wistar rat brain. Animals were exposed for 2 h a day for 60 days by using mobile phone with angular movement up to zero to 30°. The variation of the motor is restricted to 90° with respect to the horizontal plane, moving at a pre-determined rate of 2° per minute. Immediately after 60 days of exposure, animals were scarified and numbers of parameters (DNA double-strand break, micronuclei, caspase 3, apoptosis, DNA fragmentation, expression of stress-responsive genes) were performed. Result shows that microwave radiation emitted from 3G mobile phone significantly induced DNA strand breaks in brain. Meanwhile a significant increase in micronuclei, caspase 3 and apoptosis were also observed in exposed group (P < 0.05). Western blotting result shows that 3G mobile phone exposure causes a transient increase in phosphorylation of hsp27, hsp70, and p38 mitogen-activated protein kinase (p38MAPK), which leads to mitochondrial dysfunction-mediated cytochrome c release and subsequent activation of caspases, involved in the process of radiation-induced apoptotic cell death. Study shows that the oxidative stress is the main factor which activates a variety of cellular signal transduction pathways, among them the hsp27/p38MAPK is the pathway of principle stress response. Results conclude that 3G mobile phone radiations affect the brain function and cause several neurological disorders.

Therapeutic approaches of melatonin in microwave radiations-induced oxidative stress-mediated toxicity on male fertility pattern of Wistar rats.

Microwave (MW) radiation produced by wireless telecommunications and a number of electrical devices used in household or in healthcare institutions may adversely affects the reproductive pattern. Present study aimed to investigate the protective effects of melatonin (is well known antioxidant that protects DNA, lipids and proteins from free radical damage) against oxidative stress-mediated testicular impairment due to long-term exposure of MWs. For this, 70-day-old male Wistar rats were divided into four groups (n = 6/group): Sham exposed, Melatonin (Mel) treated (2 mg/kg), 2.45 GHz MWs exposed and MWs + Mel treated. Exposure took place in Plexiglas cages for 2 h a day for 45 days where, power density (0.21 mW/cm(2)) and specific absorption rate (SAR 0.14 W/Kg) were estimated. After the completion of exposure period, rats were sacrificed and various stress related parameters, that is LDH-X (lactate dehydrogenase isoenzyme) activity, xanthine oxidase (XO), ROS (reactive oxygen species), protein carbonyl content, DNA damage and MDA (malondialdehyde) were performed. Result shows that melatonin prevent oxidative damage biochemically by significant increase (p < 0.001) in the levels of testicular LDH-X, decreased (p < 0.001) levels of MDA and ROS in testis (p < 0.01). Meanwhile, it reversed the effects of MWs on XO, protein carbonyl content, sperm count, testosterone level and DNA fragmentation in testicular cells. These results concluded that the melatonin has strong antioxidative potential against MW induced oxidative stress mediated DNA damage in testicular cells.

Response of chickpea genotypes to Agrobacterium-mediated delivery of Chickpea chlorotic dwarf virus (CpCDV) genome and identification of resistance source.

Chickpea stunt disease caused by Chickpea chlorotic dwarf virus (CpCDV) (genus Mastrevirus, family Geminiviridae) is the most important biotic stress affecting chickpea crops worldwide. A survey conducted on the incidence of stunt disease clearly revealed high incidence of the disease with severe symptom expression in both indigenous and imported genotypes. To manage the disease in a sustainable way, resistant genotypes need to be bred by adopting objective and precise assessment of the disease response of chickpea genotypes. At present, evaluation of CpCDV resistance is conducted on the basis of natural infection in the field, which is bound to be erroneous due to vagaries in vector population. To circumvent the above problems, we devised an agroinoculation technique that involves the delivery of viral genomic DNA through Agrobacterium tumefaciens. An objective scoring system assigning quantitative value to different symptoms has been evolved to assess the response of chickpea genotypes to CpCDV inoculation. Using the inoculation and scoring techniques, we screened 70 genotypes, which helped in differentiating field resistance that is more due to resistance to vector feeding than resistance to the virus.

Cell phone radiation exposure on brain and associated biological systems.

Wireless technologies are ubiquitous today and the mobile phones are one of the prodigious output of this technology. Although the familiarization and dependency of mobile phones is growing at an alarming pace, the biological effects due to the exposure of radiations have become a subject of intense debate. The present evidence on mobile phone radiation exposure is based on scientific research and public policy initiative to give an overview of what is known of biological effects that occur at radiofrequency (RF)/ electromagnetic fields (EMFs) exposure. The conflict in conclusions is mainly because of difficulty in controlling the affecting parameters. Biological effects are dependent not only on the distance and size of the object (with respect to the object) but also on the environmental parameters. Health endpoints reported to be associated with RF include childhood leukemia, brain tumors, genotoxic effects, neurological effects and neurodegenerative diseases, immune system deregulation, allergic and inflammatory responses, infertility and some cardiovascular effects. Most of the reports conclude a reasonable suspicion of mobile phone risk that exists based on clear evidence of bio-effects which with prolonged exposures may reasonably be presumed to result in health impacts. The present study summarizes the public issue based on mobile phone radiation exposure and their biological effects. This review concludes that the regular and long term use of microwave devices (mobile phone, microwave oven) at domestic level can have negative impact upon biological system especially on brain. It also suggests that increased reactive oxygen species (ROS) play an important role by enhancing the effect of microwave radiations which may cause neurodegenerative diseases.

Effect of Glomus species on physiology and biochemistry of Catharanthus roseus.

The present study on efficacy of different Glomus species, an arbuscular mycorrhizal (AM) fungus (G. aggregatum, G. fasciculatum, G. mosseae, G. intraradices) on various growth parameters such as biomass, macro and micronutrients, chlorophyll, protein, cytokinin and alkaloid content and phosphatase activity of pink flowered Catharanthus roseus plants showed that all Glomus species except G. intraradices enhanced the chlorophyll, protein, crude alkaloid, phosphorus, sulphur, manganese and copper contents of C. roseus plants along with phosphatase activity significantly over uninoculated plants. However only G. mosseae and G. fasciculatum exhibited superior symbiotic relationship with the plant. G. mosseae was found to be the best for increasing the crude alkaloid content (8.19%) in leaf and also in increasing the quantity of important alkaloids vincristine and vinblastine.

Micropropagation of Clerodendrum aculeatum through adventitious shoot induction and production of consistent amount of virus resistance inducing protein.

Rapid micropropagation through adventitious shoot induction from in vitro raised leaf explants of Clerodendrum aculeatum (Verbenaceae), was successfully achieved for the first time. Basal portion of the leaves showed highest regeneration potential when grown on MS medium supplemented with BA (5.0 mg/l) and NAA and IBA (0.5 mg/l of each). Shoots after elongation in growth regulator-free medium, were rooted in MS medium containing 0.5 mg/l of NAA and IBA. Aqueous leaf extract of in vitro raised plants, induced high degree of resistance against viruses in susceptible healthy hosts when applied prior to virus inoculation. Upon purification from leaves of cultured plants, the resistance inducing protein, showed molecular mass of 34 kDa. Amount of resistance inducing protein obtained from leaves of cultured plants, was consistent throughout the year, as compared to the protein isolated from leaves of field grown plants, which showed marked seasonal fluctuation. The purified 34 kDa protein from in vitro raised plants, was serologically related to field grown plants and possessed similar characteristics. The micropropagated plants were successfully established in earthen pots under greenhouse conditions.

Improvement in bioavailability of tricalcium phosphate to Cymbopogon martinii var. motia by rhizobacteria, AMF and Azospirillum inoculation.

The interactive effects of phosphate solubilizing bacteria, N2 fixing bacteria and arbuscular mycorrhizal fungi (AMF) were studied in a low phosphate alkaline soil amended with tricalcium insoluble source of inorganic phosphate on the growth of an aromatic grass palmarosa (Cymbopogon martinii). The microbial inocula consisted of the AM fungus Glomus aggregatum, phosphate solubilizing rhizobacteria Bacillus polymyxa and N2 fixing bacteria Azospirillum brasilense. These rhizobacteria behaved as "mycorrhiza helper" and enhanced root colonization by G. aggregatum in presence of tricalcium phosphate at the rate of 200 mg kg(-1) soil (P1 level). Dual inoculation of G. aggregatum and B. polymyxa yielded 21.5 g plant dry weight (biomass), while it was 21.7 g in B. polymyxa and A. brasilense inoculated plants as compared to 14.9 g of control at the same level. Phosphate content was maximum (0.167%) in the combined treatment of G. aggregatum, B. polymyxa and A. brasilense at P1 level, however acid phosphatase activity was recorded to be 4.75 pmol mg(-1) min(-1) in G. aggregatum, B. polymyxa and A. brasilense treatment at P0 level. This study indicates that all microbes inoculated together help in the uptake of tricalcium phosphate which is otherwise not used by the plants and their addition at 200 mg kg(-1) of soil gave higher productivity to palmarosa plants.

Cloning and characterisation of a gene encoding an antiviral protein from Clerodendrum aculeatum L.

The Clerodendrum aculeatum-systemic resistance inducing (CA-SRI) protein, a 34 kDa basic protein, plays a key role in inducing strong systemic resistance in susceptible plants against various plant viruses [22]. We have cloned the cDNA encoding the CA-SRI from C. aculeatum leaves using antibodies raised against the purified protein and degenerate oligonucleotide probes derived from microsequencing of the CA-SRI protein. The full-length cDNA consisted of 1218 nucleotides with an open reading frame of 906 bp. The deduced amino acid sequence of CA-SRI protein showed varying homology (ranging from 11 to 54%) to the ribosome inactivating proteins (RIPs) from other plant species. CA-SRI inhibited in vitro protein synthesis both in rabbit reticulocyte lysate and wheat germ lysate but not in Escherichia coli in vitro translation system. The CA-SRI open reading frame was expressed in an E. coli expression vector and the purified recombinant protein inhibited protein synthesis in rabbit reticulocyte lysate. Southern blot analysis indicated that the CA-SRI gene may be present in low copy number.